|  Help  |  About  |  Contact Us

Allele : Shisa6<em1(IMPC)Tcp> shisa family member 6; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156591 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Shisa6
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR1026 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACAAGAGGTTACTATCAATC and GGGTGCTTTGGGGGCATATA targeting the 5' side and GCAGTGGTGGATATCCTGAT and GACCTTGTCCGTCCCAGAGC targeting the 3' side of a critical region. This resulted in a 719-bp del Chr11:66502466 to 66503184 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories