| Primary Identifier | MGI:6156592 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zc3h12c |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0786 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTGCTAGGACAAGGCCGAGC and AGTGGGTGCGCCGACACCGC targeting the 5' side and AGGGCCTTGTCACTCTAGGG and CAATGGCAGTCATATAGACT targeting the 3' side of exon ENSMUSE00000535007. This resulted in a 760-bp deletion of Chr9 from 52126471 to 52127230 (GRCm38). |
