| Primary Identifier | MGI:6156594 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gramd2a |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0844 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACAAGGCCCCCTTCTCAAGC and GATACTTGGGCAGGACTCAA targeting the 5' side and GGTACCCGCGTAGGTAAGCT and CAATCTAGATCCTCTTCTCG targeting the 3' side leading to a 821-bp deletion from Chr9:59709401 to 59710221 (GRCm38). |
