|  Help  |  About  |  Contact Us

Allele : Ccdc8<em1(IMPC)Tcp> coiled-coil domain containing 8; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156595 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ccdc8
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0586 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CCAGCCAGGCGGACCTCCCG and GATACGGGCCACATCTTCCA targeting the 5' side and CCAGGAGCCTCCGGGTACTA and TCCCAGTAGCTAACAAAGGC targeting the 3' side of exon ENSMUSE00000599706 resulting in a 2177-bp deletion of Chr7 from 16994417 to 16996593 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele