|  Help  |  About  |  Contact Us

Allele : Col9a3<em1(IMPC)Tcp> collagen, type IX, alpha 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156598 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Col9a3
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0893 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGCTTCCCTGAGGTCCCTTT, GCAGGACCCAAAGGTGCCCC, and ATGGTACTTACCCCAAGTCC. This resulted in a 2160-bp deletion on Chr2 from 180600526 to 180602685 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories