| Primary Identifier | MGI:6156599 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Glrb |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0720 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCTACTAGGAAAAGTCTTGG and CTCGGGTGACTGCTGACTAA targeting the 5' side and ATATAGGTATGAAGACTGGA and TTAGGCTCTGAACATTGATG targeting the 3' side resulting in a 143-bp deletion of Chr3 from 80879590 to 80879732 and a 1-bp deletion Chr3:80879862 (GRCm38). |
