|  Help  |  About  |  Contact Us

Allele : Otc<em1(IMPC)Tcp> ornithine transcarbamylase; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156601 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Otc
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR922 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AAGAGACATGCTGCACTATG and AATGCTGTGGGGTAGTCCAT targeting the 5' side and AAGCAATTACCTTGCCTGTG targeting the 3' side of a critical region. This resulted in a 258-bp del ChrX:10264681 to 10264938 and 5-bp indel ChrX:10264981 to 10264985_delCCTTT_ins AA resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories