|  Help  |  About  |  Contact Us

Allele : Prl7d1<em1(IMPC)Tcp> prolactin family 7, subfamily d, member 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156603 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Prl7d1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0724 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CAACTACGTACTTGAGAAGT and TATAGTGCCAGATCATACAG targeting the 5' side and TTGGATCTTGCTGTGTTCTC and CTCTATAAGCACCTCGGAAA targeting the 3' side of exons ENSMUSE00000289168 and ENSMUSE00000117231. This resulted in a 1667-bp deletion of Chr13 from 27712921 to 27714587 and a 3-bp deletion of Chr13 from 27714679 to 27714677. (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories