| Primary Identifier | MGI:6156603 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Prl7d1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0724 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CAACTACGTACTTGAGAAGT and TATAGTGCCAGATCATACAG targeting the 5' side and TTGGATCTTGCTGTGTTCTC and CTCTATAAGCACCTCGGAAA targeting the 3' side of exons ENSMUSE00000289168 and ENSMUSE00000117231. This resulted in a 1667-bp deletion of Chr13 from 27712921 to 27714587 and a 3-bp deletion of Chr13 from 27714679 to 27714677. (GRCm38). |
