| Primary Identifier | MGI:6156604 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ighmbp2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0651 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AACTGCCACAAGTTGCCTTC and CACATACCGTAATAACTAGC targeting the 5' side and GGAAACTGCAGAGTACGGT and ACAAAGGCCGAGCTATCTTC targeting the 3' side of a critical region. This resulted in a 3,481-bp deletion of Chr19 from 3276537 to 3280017 with insertion of insTTTC. (GRCm38). |
