|  Help  |  About  |  Contact Us

Allele : Ighmbp2<em1(IMPC)Tcp> immunoglobulin mu DNA binding protein 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156604 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ighmbp2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0651 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AACTGCCACAAGTTGCCTTC and CACATACCGTAATAACTAGC targeting the 5' side and GGAAACTGCAGAGTACGGT and ACAAAGGCCGAGCTATCTTC targeting the 3' side of a critical region. This resulted in a 3,481-bp deletion of Chr19 from 3276537 to 3280017 with insertion of insTTTC. (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele