| Primary Identifier | MGI:6156605 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Polr3b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with a single guide RNA having the spacer sequence TCATGTCCCTCAGACGGCAC resulting in a 2-bp deletion on Chr10:84632457-84632458_delCC (GRCm38). |
