|  Help  |  About  |  Contact Us

Allele : Polr3b<em2(IMPC)Tcp> polymerase (RNA) III (DNA directed) polypeptide B; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6156605 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Polr3b
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with a single guide RNA having the spacer sequence TCATGTCCCTCAGACGGCAC resulting in a 2-bp deletion on Chr10:84632457-84632458_delCC (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele