| Primary Identifier | MGI:6157331 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Trarg1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0451 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AGAATCGAAGCGTCCACAGC and TACATCTACCCTCGTCCTGG targeting the 5' side and TCGGGTGTTAGAGCCTTGGC and GCCTTAGGCCCCCTCTAGAA targeting the 3' side of exon ENSMUSE00000346888 (exon 1). This resulted in a 679 bp deletion and 2 bp insertion of Chr11 from 76679972 to 76680650, and a 15 bp deletion and 7 bp insertion of Chr11 from 76680678 to 76680692. (GRCm38). |
