|  Help  |  About  |  Contact Us

Allele : Car11<em1Sud> carbonic anhydrase 11; endonuclease-mediated mutation 1, Thomas C Sudhof

Primary Identifier  MGI:6157348 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Car11
Strain of Origin  (C57BL/6J x SJL/J)F1/J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 methodologies were used to delete 40 bp from exon 2 of the mouse Car11 gene. Two sets of gRNAs were used to ensure the production of a Car11 mutation: exon1 - CCTGAGCGCCCCTCAAGCGCTGG and CACTGGGAGCGGCAGGTAAG, and exon 2 - GCTCTCTTCCCAGCTCACATCGG and CCGAGGACTGGTGGAGCTACAAG. A 40 bp deletion in exon 2 was produced - chr7:45700427-45700466.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories