| Primary Identifier | MGI:6157348 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Car11 |
| Strain of Origin | (C57BL/6J x SJL/J)F1/J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 methodologies were used to delete 40 bp from exon 2 of the mouse Car11 gene. Two sets of gRNAs were used to ensure the production of a Car11 mutation: exon1 - CCTGAGCGCCCCTCAAGCGCTGG and CACTGGGAGCGGCAGGTAAG, and exon 2 - GCTCTCTTCCCAGCTCACATCGG and CCGAGGACTGGTGGAGCTACAAG. A 40 bp deletion in exon 2 was produced - chr7:45700427-45700466. |
