| Primary Identifier | MGI:6156488 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnf135 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0621 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTCTGACTTGTGTACTCAGG and TTGGAACAGGGCTCACACGT targeting the 5' side and GGCCATTCCCACCCAATCAG and TGATCCCTAATCCTAGTTTA targeting the 3' side of ENSMUSG00000020707. This resulted in a 2,455-bp deletion of Chr11 from 80192713 to 80195167 (GRCm38). |
