| Primary Identifier | MGI:6156489 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tagap1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0851 was generated at The Centre for Phenogenomics by electroporating Cas9 ribnucleoprotein complexes with two guide RNAs having spacer sequences of GGCGTGCTGAACCGCATCAA targeting the 5' side and TGACAGAATGCATTTCCACC targeting the 3' side of exons ENSMUSE00000658353, ENSMUSE00001018647, ENSMUSE00000975105, and ENSMUSE00000455244 resulting in a 5,812-bp deletion of Chr17 from 6955239 to 6961050 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 26 and early truncation 3 amino acids later (p.N26Kfs*5). |
