|  Help  |  About  |  Contact Us

Allele : Tmem209<em1(IMPC)Tcp> transmembrane protein 209; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156490 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tmem209
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0448 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ATGGCTCGCTAGTAAGCTAG and CATCTGCCACTCTAATTAAG targeting the 5' side and GGTCACCAGCTGGTTTCAGC and TCACACCTGGGATCCTCATG targeting the 3' side of exon ENSMUSE00001236619 (exon 4) and ENSMUSE00001262606 (exon 5) resulting in a 2180 bp deletion of Chr6 from 30505369 to 30507548 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories