|  Help  |  About  |  Contact Us

Allele : Cep55<em1(IMPC)Tcp> centrosomal protein 55; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156491 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cep55
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele, from project TCPR0420, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATAATTCCGTCTCACCTATG, ATTCCCTCCAGAGCTGACCT, CTAAATAGATGGATAAGCTC and CGCATGGCGGCCTCGCAGAA. This resulted in a 601-bp deletion in Chr19 from 38069489 to 38070089 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

6 Publication categories

Trail: Allele