| Primary Identifier | MGI:6156491 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cep55 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele, from project TCPR0420, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATAATTCCGTCTCACCTATG, ATTCCCTCCAGAGCTGACCT, CTAAATAGATGGATAAGCTC and CGCATGGCGGCCTCGCAGAA. This resulted in a 601-bp deletion in Chr19 from 38069489 to 38070089 (GRCm38). |