|  Help  |  About  |  Contact Us

Allele : Wdr62<em1(IMPC)Tcp> WD repeat domain 62; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156494 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Wdr62
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0452 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CTATCTTACGTGACAGAATG and TAGCATCGCCTCTAACCGCA targeting the 5' side and GCCCCTCCCAGTTGAAGTCC and CCGAAGTCATAGTAGCTACC targeting the 3' side of exon ENSMUSE00000343496 (exon 11). This resulted in a 849 bp deletion of Chr7 from 30261130 to 30261978. (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories