|  Help  |  About  |  Contact Us

Allele : Hyls1<em1(IMPC)Tcp> HYLS1, centriolar and ciliogenesis associated; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156495 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Hyls1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0683 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of GCAGCTAACATTCGTTCTTC and CTTTACTGTAGGGATCATAC targeting the 5' side and ACAACGCACACCCCACCGAA targeting the 3' side of exon ENSMUSE00000701722 resulting in a 685-bp deletion of Chr9 from 35561247 to 35561931 (gRNA_U3 to gRNA_D). This mutation is predicted to cause a frameshift with the amino acid changes after residue 63 and early truncation 38 amino acids later (c.188_872del, p.D63Gfs*40). (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories