|  Help  |  About  |  Contact Us

Allele : Jade2<em1(IMPC)Tcp> jade family PHD finger 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156496 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Jade2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0859 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGGACGGCTTCGTAGGCCAG and CCGGAAAACCTGCAGACATG targeting the 5' side and CTAGGAACGAATCTCAGAAC and GTTACTTACCCATGAGGCTT targeting the 3' side. This resulted in a 299-bp deletion Chr11:51835490 to 51835788 and Chr11:51835395_delCinsAGTAAGTA (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories