| Primary Identifier | MGI:6156496 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Jade2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0859 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGGACGGCTTCGTAGGCCAG and CCGGAAAACCTGCAGACATG targeting the 5' side and CTAGGAACGAATCTCAGAAC and GTTACTTACCCATGAGGCTT targeting the 3' side. This resulted in a 299-bp deletion Chr11:51835490 to 51835788 and Chr11:51835395_delCinsAGTAAGTA (GRCm38). |