|  Help  |  About  |  Contact Us

Allele : Katnal2<em1(IMPC)Tcp> katanin p60 subunit A-like 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156497 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Katnal2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0845 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TAACGTTCCTTGCTGAAGAG and CTCTTTGTCGTGAGTCCCCT targeting the 5' side and GCTAAGAATGGCGTTCCCAG and TGAGCCTAGGAACACGGGAC targeting the 3' side leading to a 368-bp deletion from Chr18:77017405 to 77017772_insCCA (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele