|  Help  |  About  |  Contact Us

Allele : Snd1<em1(IMPC)Tcp> staphylococcal nuclease and tudor domain containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156505 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Snd1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0864 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCAGTTGGATTAAGTAGCAC and TCTTTGGTCTAGCGAGATTG targeting the 5' side and TCCTAGAGCTATGGACATGG and GTGCATACCTCTAGCAGCCC targeting the 3' side of a critical region. This resulted in a 12-bp deletion Chr6:28519921 to 28519932; 325-bp deletion Chr6:28520030 to 28520354; 11- bp deletion Chr6:28520400 to 28520410 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories