| Primary Identifier | MGI:6156508 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Btnl4 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from projects TCPR0881 and TCPR0882 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and two guide RNAs with spacer sequences of GCAAGGAGTGTTCTATGATG targeting the 5' side and GGAGCATTCTGCAAGGCTGA targeting the 3' side of exons ENSMUSE00000141100 and ENSMUSE00000456939 resulting in a 1372-bp deletion of Chr17 from 34472676 to 34474047 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 131 and early truncation 10 amino acids later (p.Q131Hfs*12). |
