| Primary Identifier | MGI:6156510 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mllt6 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0432 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCCTGTGACATTGCGTTTAC and CTGGACAGTACTGATCTGGA targeting the 5' side and GCCACGCCATGCTTAGGTCT and GGTAGGATGCTCCCACTCGG targeting the 3' side of exon ENSMUSE00001228124 (exon 5) resulting in a 316 bp deletion of Chr11 from 97666685 to 97667000, with a 19 bp insertion of GACGCCACGCCATGCTTAG.(GRCm38). |
