| Primary Identifier | MGI:6246513 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Del(13Naip1-Naip5)1Vnce |
| Strain of Origin | B6(Cg)-Tyr<c-2J>/J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A single guide RNA (sgRNA; sequence GGTCAGAAGAGAATTACCTA) with protospacer adjacent motif (PAM; sequence TGG) targeted Cas9 to a 20-nucleotide sequence in exon 6 (the fourth coding exon) in each of the four functional mouse Naip genes (Naip1, 2, 5, and 6). The sequence between Naip5 exon 6 and Naip1 exon 6 was deleted including Naip3 and Naip6, leading to a nonfunctional fusion of Naip5 and Naip1. It also resulted in a 4 bp frameshift deletion in Naip2 gene Naip2em2Vnce. |