| Primary Identifier | MGI:6256533 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ndc80 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGGTAAGATAAGAACCAT and GTATAAGAGTATTTAAGGAG, which resulted in a 364 bp deletion beginning at Chromosome 17 position 71,518,724 bp and ending after 71,519,087 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000137722 (exon 6) and 261 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 159 and early truncation 4 amino acids later. |
