|  Help  |  About  |  Contact Us

Allele : Ulk3<em2(IMPC)Tcp> unc-51-like kinase 3; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6157270 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ulk3
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0440 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ATCAACGAGGCATCCGGATT and TTTGAAGGGGCCGACCCCAT targeting the 5' side and GACTTAACAGAGCGACCCCT and GAGCTGAGCCCGGCGCCAAA targeting the 3' side of exons ENSMUSE00000258949, ENSMUSE00000218586, and ENSMUSE00000258920 (exons 2-4) resulting in a 1,345-bp deletion of Chr9 from 57590144 to 57591488 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

6 Publication categories