| Primary Identifier | MGI:6158427 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Iigp1c |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 RNA and 2 guide sequences TAGATCAGGTAGATCAGGTGAGG, GGTGAGAGCAACATTGAGCGGGG, which resulted in a Exon Deletion. |
