| Primary Identifier | MGI:6164046 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rigi |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TATGGGTTTCAATTATCCTT, TTAGAGGTGACCACACCCTG, CAAACAGTGCAACAATTAAA and GGGAATCCTGTTCAAATCAG, which resulted in a total of 688 bp deletion beginning at Chromosome 4 position 40,229,215 bp for 523 bp followed by a 4 bp endogenous retention (TCTA) then a further 165 bp deletion ending after 40,229,902 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001299001 (exon 3) and 506 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 80 and early truncation 4 amino acids later. |
