| Primary Identifier | MGI:6164048 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Appbp2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGGTGGTGGATATTTTGG and ACAACTCTCGCTGCCGGGCG, which resulted in a 237 bp deletion beginning at Chromosome 11 position 85,216,273 bp and ending after 85,216,509 bp (GRCm38/mm10). This mutation deletes all but the first 15 bp of ENSMUSE00000105717 (exon 2) and 163 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 15 amino acids later due to read through into the intron between exons 2 and 3. |
