| Primary Identifier | MGI:6164028 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnf123 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGCCATCAGGATAAGCGTAG, GGCTGAAGCTCCAGACCAGC, GCTTGGAGTGGTGTCAAGAT and GGTGACAGGGACTTACTGTT, which resulted in a 536 bp deletion beginning at Chromosome 9 position 108,071,036 bp and ending after 108,071,571 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001214626 and ENSMUSE00001209882 (exons 4 and 5) and 361 bp of flanking intronic sequence including the splice acceptors and donors. In addition, there is a 47 bp inverted sequence from the deleted region Chr9:108071521-108071567 (TCACCCTTCTCCTTGAACACTGGAGGATGCTTGGCTGAAGCTCCAGA) at the deletion site that is not predicted to alter the results of the exon deletion. This deletion is predicted to cause an early truncation after amino acid 56. |
