|  Help  |  About  |  Contact Us

Allele : Srsf5<em1(IMPC)J> serine and arginine-rich splicing factor 5; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6164004 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Srsf5
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTATAGTATCTGAGTGTA and TAGGGTCCGTTAGCATTAAA, which resulted in a 694 bp deletion beginning at Chromosome 12 position 80,947,084 bp and ending after 80,947,777 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001244447 and ENSMUSE00001218869 (exons 3 and 4) and 524 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 13 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories