| Primary Identifier | MGI:6164004 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Srsf5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTTATAGTATCTGAGTGTA and TAGGGTCCGTTAGCATTAAA, which resulted in a 694 bp deletion beginning at Chromosome 12 position 80,947,084 bp and ending after 80,947,777 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001244447 and ENSMUSE00001218869 (exons 3 and 4) and 524 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 13 amino acids later. |
