| Primary Identifier | MGI:6164012 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Med12l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GCGAAGCACACTTACAGAGG, TCTGTCTAGACAAGAGACGA, AGTGCATGCAGTTTGAAAGG and GGAACAGTTACGTGGACTGG, which resulted in a 468 bp deletion beginning at Chromosome 3 position 59,042,183 bp and ending after 59,042,650 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000173265 (exon 4) and 308 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 41 amino acids later. |
