| Primary Identifier | MGI:6161422 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Trank1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 4 guide sequences CTTAACCCCCTAAAAGGACG, AAAGCAATCAAATCAAGAGG, ATATTTGTATTGATTGGTGT and AGAAGAGCAAGTGCGTTCAA, which resulted in a 606 bp deletion beginning at Chromosome 9 position 111,333,325 bp and ending after 111,333,930 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000366889(exon 2) and 479 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 137 and early truncation 48 amino acids later. |
