| Primary Identifier | MGI:6161425 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Trpa1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 mRNA and 4 guide sequences AACAGTAAGTGAGTCAGATG, TTAGCTTCAGAATTACCCAA, ACGTTTCATTTGCCATGACA and CTTGACTCCGAGGTTCGGAG, which resulted in a 440 bp deletion beginning at Chromosome 1 position 14,910,623 bp and ending after 14,911,062 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000324427 (exon 3) and 264 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 90 and early truncation 3 amino acids later |