| Primary Identifier | MGI:6187994 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Psmd6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TTTGCACTGATGTACAACAT, GCTAAGATCGGCTCTCAAGC, AGCACCTCTCATCTGCAGAG and TGATCGCGACTAAGGCCAAG, which resulted in a 548 bp deletion beginning at Chromosome 14 position 14,119,831 bp and ending after 14,120,378 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000120407 (exon 2) and 342 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (G) insertion at the deletion site that will not alter the results of the exon deletion and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 12 amino acids later. |
