|  Help  |  About  |  Contact Us

Allele : Psmd13<em1(IMPC)J> proteasome (prosome, macropain) 26S subunit, non-ATPase, 13; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6188002 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Psmd13
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 2 guide sequences TTTAACTCCTGGCTGTGCAG and TCAACATCGTCTGAGCTGTC, which resulted in a 208 bp deletion beginning at Chromosome 7 position 140,883,394 bp and ending after 140,883,601 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001295831 (exon 2) and 129 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 13 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories