| Primary Identifier | MGI:6161380 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ankrd52 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGTGCACCTCTCTTTTCAGG, GGGCAAGTTTCACCCTTTGG, CAATGTTGCAAACACAAAGG and GGGTGGAGCTTAGGGCCTTT, which resulted in a 237 bp deletion beginning at Chromosome 10 position 128,380,503 bp and ending after 128,380,739 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261771 (exon 6) and 149 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 33 bp deletion (TTTGGGGGTGGAGCTTAGGGCCTTTGGGTTTAC) 58 bp after the exon deletion and a 4 bp insertion (GTCC) at the exon deletion site, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 154 and early truncation 2 amino acids later. |
