|  Help  |  About  |  Contact Us

Allele : Psmd2<em1(IMPC)J> proteasome (prosome, macropain) 26S subunit, non-ATPase, 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6161408 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Psmd2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences AACTCAAGAGTAATAAACAA and TTAATTGTTCTAATTGTATT, which resulted in a 1640 bp deletion beginning at Chromosome 16 position 20,654,355 bp and ending after 20,655,994 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001269400, ENSMUSE00001242405, ENSMUSE00001235947, ENSMUSE00001282580, ENSMUSE00001296185 (exons 4-8) and 928 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 13 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories