| Primary Identifier | MGI:6161408 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Psmd2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences AACTCAAGAGTAATAAACAA and TTAATTGTTCTAATTGTATT, which resulted in a 1640 bp deletion beginning at Chromosome 16 position 20,654,355 bp and ending after 20,655,994 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001269400, ENSMUSE00001242405, ENSMUSE00001235947, ENSMUSE00001282580, ENSMUSE00001296185 (exons 4-8) and 928 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 13 amino acids later. |
