| Primary Identifier | MGI:6188059 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ppfia1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGCTCTGTGGGTATGCAA, GCAACTCTCTCACATGGACT, GCTGCTGTCTCTGCGGGCGT and GGTGATAGACAAGTTAAAAG, which resulted in a 330 bp deletion beginning at Chromosome 7 position 144,510,211 bp and ending after 144,510,540 bp (GRCm38/mm10). This deletes ENSMUSE00000873361 (exon 13) and 250 bp of flanking intronic sequence including the splice acceptor and donor. In addition, a 55 bp sequence corresponding to Chr 7:144512416-144512470, from the upstream intron between exons 11 and 12, and inserted into the deletion site. This mutation is predicted to cause a change of amino acid sequence after residue 496 and early truncation 41 amino acids later. |