| Primary Identifier | MGI:6188963 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Coro2b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GCCACAGTCAGCAGGCAGAT, AGAGAAGCAACGAGAGTAGA, GGACCCACACGTGCCACCTT and TGGTAGCTCTACTAGGGGCA, which resulted in a 358 bp deletion beginning at Chromosome 9 position 62,427,786 bp and ending after 62,428,143 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001375364 (exon 8) and 261 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 290 and early truncation 21 amino acids later. |
