| Primary Identifier | MGI:6188969 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rusc2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTAGTCCAGGAGCTACTACA, GGGATGCCTTTACCCCACCG, CGTGGGTCTTTCCTTTTCCG and CTGCCTGGAAGGAGACCGGA, which resulted in a 1006 bp deletion beginning at Chromosome 4 position 43,423,415 bp and ending after 43,424,420 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001313395, ENSMUSE00001264890, ENSMUSE00001301458 (exons 6,7,8) and 648 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 998 and early truncation 49 amino acids later. |
