| Primary Identifier | MGI:6189578 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Wdr90 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTAAGGTCTGCTGGGCTAAA, TTACGATTCTAGGACCTCAG, GGTGGGACGAGTGAGTTTTA and CTGGAAATAGGCCCAGAGAA, which resulted in a 1250 bp deletion beginning at Chromosome 17 position 25,858,456 bp for 1187 bp followed by an endogenous 4 bp retention (TCTG) then an additional 63 bp deletion ending after 25,859,709 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001267257, ENSMUSE00001247912, ENSMUSE00001253441 (exons 7-9) and 858 bp of flanking intronic sequence including the splice acceptor and donor. Eighteen bp before the exon deletions there is an 11 bp deletion that will not alter the results of the exon deletions. Overall, the exon deletions are predicted to cause a change of amino acid sequence after residue 323 and early truncation 23 amino acids later. |