| Primary Identifier | MGI:6189599 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zc3h7a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AGGCCCTGTGCCCAGCCATA, GGCTGAATTATGCTGATAGA, GTACCCTTTCGGGGCATTTC and TAAAAGTTTTGTTAGTTCTA, which resulted in a 519 bp deletion beginning at Chromosome 16 position 11,162,346 bp and ending after 11,162,864 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000563629 (exon 3) and 479 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 23 and early truncation 6 amino acids later. |
