|  Help  |  About  |  Contact Us

Allele : Mecp2<em4Bird> methyl CpG binding protein 2; endonuclease-mediated mutation 4, Adrian Bird

Primary Identifier  MGI:6199505 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Mecp2
Strain of Origin  (C57BL/6J x CBA/CaOlaHsd)F2 Is Recombinase  false
Is Wild Type  false
molecularNote  A deletion was engineered in exon 4 using synthetic tracrRNA (trans-activating crRNA), crRNA (CRISPR RNA) (target sequence ACCTGAGCCTGAGAGCTCTG) and an oligonucleotide repair template using CRISPR/Cas9 technology. This mutation is associated with human Rett syndrome. The mRNA levels from this allele are 45% of wild-type and protein expression 10%.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • CTD1,
  • CTD1
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories