| Primary Identifier | MGI:6199505 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Mecp2 |
| Strain of Origin | (C57BL/6J x CBA/CaOlaHsd)F2 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A deletion was engineered in exon 4 using synthetic tracrRNA (trans-activating crRNA), crRNA (CRISPR RNA) (target sequence ACCTGAGCCTGAGAGCTCTG) and an oligonucleotide repair template using CRISPR/Cas9 technology. This mutation is associated with human Rett syndrome. The mRNA levels from this allele are 45% of wild-type and protein expression 10%. |
